View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_low_25 (Length: 242)
Name: NF15108_low_25
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_low_25 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 11544 - 11769
Alignment:
| Q |
7 |
gtttgaaatgaaagaaaatggtaaaagagtagtaaatgtcagccccgaaacttcggttagagatgatagcgttgagcaagggaggaacagaatgaaggct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11544 |
gtttgaaatgaaagaaaatggtaaaagagtagtaaatgtcagccccgaaacttcggttagagatgatagcgttgagcaagggaggaacagaatgaaggct |
11643 |
T |
|
| Q |
107 |
ttgaaggttaaattattaggttttcgtatgagaaggttaagaaaacagcgcagagctaaaatttcataccatgttaaagaagaaattaggttttcagact |
206 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
11644 |
ttgaaggttaagttattaggttttcgtatgagaaggttaagaaaacagcgcagagctaaaatttcataccatgttaaagaagaaatttggttttcagatt |
11743 |
T |
|
| Q |
207 |
aagttttcatatgatcactgcctttg |
232 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
11744 |
aagttttcatatgatcactgcttttg |
11769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University