View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15108_low_27 (Length: 236)
Name: NF15108_low_27
Description: NF15108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15108_low_27 |
 | |
|
| [»] scaffold0627 (1 HSPs) |
| | |
|
| [»] scaffold0042 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0627 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 180
Target Start/End: Complemental strand, 2533 - 2361
Alignment:
| Q |
9 |
ttaagttcatagcctagtttgaaaattattagaggattgaaagctttctgtttgttaaaaataaat-atgagcaccgaatttatattagtggctatgcag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2533 |
ttaagttcatagcctagtttgaaaattattagaggattgatagctttctgtttgttaaaaataaattatgagcaccgaatttatattagtggctatgcag |
2434 |
T |
|
| Q |
108 |
gatataaatcgttgatttaagaaccgtaactcttgattggatttagaatttgaaaacaataccttatctctac |
180 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2433 |
gatataaatcgttgatataagaaccgtaactcttgattggatttagaatttgaaaacaacaccttatctctac |
2361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 6965 - 6928
Alignment:
| Q |
181 |
ttcgatctagttcggactgtggggttgtaggtggttga |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
6965 |
ttcgatgtagttcggactgtggggttgtaggtagttga |
6928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 181 - 218
Target Start/End: Complemental strand, 14377 - 14340
Alignment:
| Q |
181 |
ttcgatctagttcggactgtggggttgtaggtggttga |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
14377 |
ttcgatgtagttcggactgtggggttgtaggtagttga |
14340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University