View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15109_high_11 (Length: 253)
Name: NF15109_high_11
Description: NF15109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15109_high_11 |
 | |
|
| [»] scaffold0318 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0318 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 1846 - 1988
Alignment:
| Q |
96 |
acttgataggtgttaataagcctaaaatctcacccttctagacattaagaaaaaggttgcaatctcaattcagaccttatatcgaaagaagaagaaaaac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1846 |
acttgataggtgttaataagcctaaaatctcacccttcttgacattaagaaaaaggttgcaatctcaattcagaccttatatcgaaagaagaagaaaaac |
1945 |
T |
|
| Q |
196 |
ttgaatgaaattatatgcaactattttagattgaggccctttg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1946 |
ttgaatgaaattatatgcaactattttagattgagtccctttg |
1988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0318; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 1720 - 1828
Alignment:
| Q |
1 |
acattggttccaacattatttgacaagttaaaagtccaatacacccttcgaatccaaagtaaaaataacactcttgaactctaatagccgcatccacttg |
100 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
1720 |
acattggttccaacattgtttgataagttaaaagtccaatacaccctttgaatccaaagtaaaaataacactcttgaactctaatcgccgcatcaacttg |
1819 |
T |
|
| Q |
101 |
ataggtgtt |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
1820 |
ataggtgtt |
1828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University