View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15109_high_8 (Length: 289)
Name: NF15109_high_8
Description: NF15109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15109_high_8 |
 | |
|
| [»] scaffold0318 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0318 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 21 - 272
Target Start/End: Original strand, 1466 - 1719
Alignment:
| Q |
21 |
agtgtagggcggtgcaacaagaatatgggcaggttgctcgtctacaactgcatgttgataacattcagacgtggaagcgacctctgcacgagttcattag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
1466 |
agtgtagggcggtgcaacaagaatatgggcaggttgctcgtctgcaactgcatgttgataacattcagccgtggaagcgacctctgcacgagttcatcag |
1565 |
T |
|
| Q |
121 |
gcgcaatataacttcatgttcaaaacaagagttgtatatgaccaccttagtaagattatgagcaatcgtgttat--tctctcttagaaaattcgatataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||| |||| |
|
|
| T |
1566 |
gcgcaatataacttcatgttcaaaacaagagttgtatatgaccaccttagtaagattatgagcaatcgtgttattctctctcttaaaaaactcgacataa |
1665 |
T |
|
| Q |
219 |
gaattgttacaaaatgatgataaagtactatgacatctatttaaaatgaaacct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1666 |
gaattgttacaaaatgatgataaagtactacgatatctatttaaaatgaaacct |
1719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University