View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15109_low_4 (Length: 440)
Name: NF15109_low_4
Description: NF15109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15109_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 36 - 440
Target Start/End: Original strand, 45702846 - 45703251
Alignment:
| Q |
36 |
caagtcagttcatctccaatgaatgaatttcctcgttaatggccttcaaactattttagactctcattgctctcaaatgcttttttgaaggcctttgttt |
135 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||| ||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45702846 |
caagttagttcatctccaatgaatgaatttcctcattcatggcctt-aaactatttcagactctcattgctctcaaatgctttcttgaaggcctttgttt |
45702944 |
T |
 |
| Q |
136 |
ctaagtttttcaacctttcatctgcatttagagcataaaaaatatgaacaacaaagcgatatcttattggtggaacaatatccctatattcctcatctct |
235 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45702945 |
ctaagtttttcaacctttcatccgcatttagagcataaaaaatatggacaacaaagccatatcttattggtggaacaatatccctatattcctcatctct |
45703044 |
T |
 |
| Q |
236 |
atccaattgatggtcaaaatccgttgttgtttgtcttcctctag--tatttgatggaggagtctcaccctcttctttgtctcttgtctcactagtggaag |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45703045 |
atccaattgatggtcaaaatccgttgttgtttgtcttcctctagtatatttgatggaggagtctcaccctcttctttgtctcttgtctcactagtggaag |
45703144 |
T |
 |
| Q |
334 |
gctccaactcaaactatgttttcttctactttgtttctgagtgaatattcaataggtccttgcacttcatccacatattggtctcatcaaaaataatatt |
433 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45703145 |
gctccaactcaaactaagttttcttctactttgtttctgagtgaatattcagtaggtccttgcacttcatccacatattggtctcatcaaaaataatatt |
45703244 |
T |
 |
| Q |
434 |
tatgctt |
440 |
Q |
| |
|
||||||| |
|
|
| T |
45703245 |
tatgctt |
45703251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University