View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15109_low_8 (Length: 304)
Name: NF15109_low_8
Description: NF15109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15109_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 2636331 - 2636051
Alignment:
| Q |
14 |
atatcaactttatcaaatctaaaagagcaaaatacattttaaatagtcnnnnnnnn---ttatcaagaatattaacactttataatataatagtacaata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2636331 |
atatcaactttatcaaatctaaaagagcaaaatacatcttaaatagtcaaaaaaaaaaattatcaagaatattaaaactttataatataatagtacaata |
2636232 |
T |
|
| Q |
111 |
ccttaaaagttggtaatggagatggagtctcaattcttggcctcttaactgcagtttctgatgaatttttcgtttctggagatttttctcttttcagctg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2636231 |
ccttaaaagttggtaatggagatggagtctcaattcttggcctcttaactgcagtttctgatgaatttttcgtttctggagatttatctcttttcagctg |
2636132 |
T |
|
| Q |
211 |
--cacatagataaatttttataatatgttattattctttagccnnnnnnngccctaattttagctaaccatagattgttta |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2636131 |
cacacatagataaatttttataatatgttattattctttagccaaaaaaagccctaattttagctaaccatagattgttta |
2636051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University