View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_high_16 (Length: 366)
Name: NF1510_high_16
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 32111544 - 32111730
Alignment:
| Q |
11 |
cacagatgcacacacgttttcccatagactctcttcttttgagatggaacaaaatgctgcacatgtgcaagctaaactagccaacgcagggccatcaagc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32111544 |
cacagatgcacacacgttttcccatagactctcttcttttgagatggaacaaaatgctgcacatgtgcaagctaaactagccaacgcagggccatcaagc |
32111643 |
T |
 |
| Q |
111 |
cgtcttaatatgtcatagaagagatcactactcaatgaggtcatgctatcaatcggtgcgattgacatagtaacaatcctgtctgtc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32111644 |
cgtcttaatatgtcatagaagagatcactattcaatgaggtcatgctatcaatcggtgcgattgacatagtaacaatcctggctgtc |
32111730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 262 - 348
Target Start/End: Original strand, 32111795 - 32111881
Alignment:
| Q |
262 |
ttaaattagtgattttcaaacattaaacaataatggggcataaaacgttttgctaacatggaattcacaattatgttacgactagtg |
348 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32111795 |
ttaaatgagtgattttcaaacattaaacaataatggggcataaaacgttttgctaacatggaattcacaattatgttacgactagtg |
32111881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University