View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1510_high_21 (Length: 311)

Name: NF1510_high_21
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1510_high_21
NF1510_high_21
[»] chr4 (2 HSPs)
chr4 (4-258)||(4105048-4105300)
chr4 (269-305)||(4103173-4103209)
[»] chr3 (1 HSPs)
chr3 (37-81)||(53523149-53523193)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 4 - 258
Target Start/End: Complemental strand, 4105300 - 4105048
Alignment:
4 tctctctctcttcaccctttggtgagactcacataataaattgtatcaaaataaataagttatgttgaaatgtaatgatatggagttatattgattagac 103  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||    
4105300 tctctctctcttcatcctttggtgagactcacataataaattgtatcaaaatatataagttatgtt-aaatgtaatgatatggagttatattgattagac 4105202  T
104 ttatttaatatcnnnnnnnaggttatgggttagatagattggatgtttattaagtattattaacatt-nnnnnnnnttaaggatatatgaatatgattgg 202  Q
    ||||||||||||       ||||||||||||| | |||||  |||||||| |||||||||||| |||         ||||||||||||||||||||||||    
4105201 ttatttaatatc-ttttttaggttatgggttatagagattaaatgtttatcaagtattattaatattaaaaaaaaattaaggatatatgaatatgattgg 4105103  T
203 tttgacggataaggtaggaaatcataagagagggtgataagaatgtctagatccct 258  Q
    ||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||    
4105102 tttgacggataaggtgggaaatcat-agagagggtgatgagaatgtctagatccct 4105048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 269 - 305
Target Start/End: Complemental strand, 4103209 - 4103173
Alignment:
269 gaatgtctagagtttaatgggcattcagagcataata 305  Q
    |||||||||||||||||||||||||||||||||||||    
4103209 gaatgtctagagtttaatgggcattcagagcataata 4103173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 81
Target Start/End: Complemental strand, 53523193 - 53523149
Alignment:
37 taataaattgtatcaaaataaataagttatgttgaaatgtaatga 81  Q
    ||||||||||||| ||||| |||||||| | ||||||||||||||    
53523193 taataaattgtataaaaatgaataagttttattgaaatgtaatga 53523149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University