View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_10 (Length: 431)
Name: NF1510_low_10
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 8e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 3984671 - 3984579
Alignment:
| Q |
1 |
attttgttgagcaaatggtattgttagatcatattaacaaatggaagaggactgtgctgcttagtattatcctatgtatttccttactgcagc |
93 |
Q |
| |
|
|||| ||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
3984671 |
atttcgttgagcaaatggaattgtttgatcgtattaacaaatggaagaggactgtgctgcttagcatcatcctatgtatttccttactgcagc |
3984579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 83
Target Start/End: Complemental strand, 4007574 - 4007507
Alignment:
| Q |
13 |
aaatggtattgttagatcatattaacaaatggaagaggactgtgctgcttagtattatcctatgtatttcc |
83 |
Q |
| |
|
|||||| |||||| ||| |||| ||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
4007574 |
aaatggaattgtttgattatatgaacaaatggaataggactg---tgcttagtatcatcctatgtatttcc |
4007507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 348 - 414
Target Start/End: Complemental strand, 11654330 - 11654264
Alignment:
| Q |
348 |
gtgggttatggggagtagaaggggtagggtaatcatgtgaaggagtaggtgtagaaggggtaggata |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654330 |
gtgggttatggggagtagaaggggtagggtaatcatgtgaaggagtaggtgtagaaggggtaggata |
11654264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 348 - 414
Target Start/End: Complemental strand, 11668095 - 11668029
Alignment:
| Q |
348 |
gtgggttatggggagtagaaggggtagggtaatcatgtgaaggagtaggtgtagaaggggtaggata |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11668095 |
gtgggttatggggagtagaaggggtagggtaatcatgtgaaggagtaggtgtagaaggggtaggata |
11668029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 144 - 190
Target Start/End: Complemental strand, 11654549 - 11654503
Alignment:
| Q |
144 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654549 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
11654503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 144 - 190
Target Start/End: Complemental strand, 11668314 - 11668268
Alignment:
| Q |
144 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11668314 |
gagtagacgatgagggtggtgggtttttcggtgtagaagggctttta |
11668268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 11654418 - 11654384
Alignment:
| Q |
269 |
ttatgttggttatgtggtggagaagagctattagg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11654418 |
ttatgttggttatgtggtggagaagagctattagg |
11654384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 303
Target Start/End: Complemental strand, 11668183 - 11668149
Alignment:
| Q |
269 |
ttatgttggttatgtggtggagaagagctattagg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11668183 |
ttatgttggttatgtggtggagaagagctattagg |
11668149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University