View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_19 (Length: 364)
Name: NF1510_low_19
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 10 - 347
Target Start/End: Original strand, 39007651 - 39007988
Alignment:
| Q |
10 |
ataattcttgtcatgtttctgatggatattttttcttgatttcaggttccattatatgtggcaacaaagatggcatcaatcaggagatcttcattctttg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39007651 |
ataattcttgtcatgtttctgatggatattttttcttgatttcaggttccattatatgtggcaacaaagatggcatcaatcaggagatcttcattctttg |
39007750 |
T |
 |
| Q |
110 |
ttccatcaacagacggctatgcaaaagcaggtgtgaaatggataggatatgaacctcgttgcacaccatactggccacatacccttctatgggccgtggc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39007751 |
ttccatcaacagacggctatgcaaaagcaggtgtgaaatggataggatatgaacctcgttgcacaccatactggccacatacccttctatgggccgtggc |
39007850 |
T |
 |
| Q |
210 |
acgctcgctgccagagtctatagttgatacttggcgccttgggttttgtatgggtattagaaagagggggcagctcaaagattcgaagaagcaggaataa |
309 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39007851 |
acgttcgctgccagagtctatagttgatacttggcgccttgggttttgtatgggtattagaaagagggggcagctcaaagattcgaagaagcaggaataa |
39007950 |
T |
 |
| Q |
310 |
ataaaaccatgcttgtctgtttgtattgtgtaggcata |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39007951 |
ataaaaccatgcttgtctgtttgtattgtgtaggcata |
39007988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University