View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_22 (Length: 337)
Name: NF1510_low_22
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 181 - 315
Target Start/End: Complemental strand, 4303454 - 4303321
Alignment:
| Q |
181 |
tcttattttctgatgggttgttatgaatttcttccttcatactgaaacactgtggaacagtgtttttgagaagtttaaggtttatgttgtgttgtaagaa |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4303454 |
tcttattttctgatgggttgttatgaatttcttccttcatactgaaacactgtggaacagtgtttt-gagaagtttaaggtttatgttgtgttgtaagaa |
4303356 |
T |
 |
| Q |
281 |
cagaacaacaatgttggatttgggggttttgttat |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4303355 |
cagaacaacaatgttggatttgggggttttgttat |
4303321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 47 - 87
Target Start/End: Complemental strand, 4303588 - 4303548
Alignment:
| Q |
47 |
gtcagctgaaaaaccttttacaatgtgtgcgccccataacc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4303588 |
gtcagctgaaaaaccttttacaatgtgtgcaccccataacc |
4303548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University