View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_35 (Length: 259)
Name: NF1510_low_35
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 72 - 193
Target Start/End: Complemental strand, 5555178 - 5555057
Alignment:
| Q |
72 |
cttccatatttgatgcaatggtgtaattttagaacggatcatacaatacaatatgagtccgatacaaatttgactgtatattcttataaaagaattgata |
171 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5555178 |
cttccatatttgatgcgatgatgtaattttagaacggatcatacaatacaatgtgagtccgatacaaatttgactgtatatttttataaaagaattgatc |
5555079 |
T |
|
| Q |
172 |
ggattgttttgccttgaacatc |
193 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5555078 |
ggattgttttgccttgaacatc |
5555057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 73 - 124
Target Start/End: Complemental strand, 5555018 - 5554967
Alignment:
| Q |
73 |
ttccatatttgatgcaatggtgtaattttagaacggatcatacaatacaata |
124 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5555018 |
ttccatatttgatgtgatggtgtaattctagaacggctcatacaatacaata |
5554967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University