View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_37 (Length: 249)
Name: NF1510_low_37
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 49433591 - 49433351
Alignment:
| Q |
9 |
agatgaatggatgcaaataattgtgttcaattttgaaatggtaatttctcggatgatcagtcaagcaattaattgaatatattttgggataaactgtgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49433591 |
agatgaatggatgcaaataattgtgttcaattttgaaatggtaatttctcggatgatcagtcaagcaattgattgaatatattttgggataaactgtgtc |
49433492 |
T |
 |
| Q |
109 |
aagagctctgcatatactattcatgaatgtcctgccttgccattccttgacagtcatactaatgtttctttcatcttgactgattatatttttcatctta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49433491 |
aagagctctgcatatactattcatgaatgtcttgccttgccattccttgacagtcatactaatgtttctttcatcttgactgattatatttttcatctta |
49433392 |
T |
 |
| Q |
209 |
ttgnnnnnnnnnnatttgactcatattcaaaatgctctgcc |
249 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
49433391 |
ttgttttttttttatttgactcatattcaaaatgctctgcc |
49433351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 22377848 - 22377612
Alignment:
| Q |
13 |
gaatggatgcaaataattgtgttcaattttgaaatggtaatttctcggatgatcagtcaagcaattaattgaatatattttgggataaactgtgtcaaga |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22377848 |
gaatggatgcaaataactgtgttcaattttgaaatggtaatttcttggatgatcagtcaagcaattaattgaatatattttgggataaactgtgtcaaga |
22377749 |
T |
 |
| Q |
113 |
gctctgcatatactattcatgaatgtcctgccttgccattccttgacagtcatactaatgtttctttcatcttgactgattatatttttcatcttattgn |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22377748 |
gctctgcatatactattcatgaatgtcctaccttgccatgccttcacagtcatactaatgtttctttcatcttgactgattatatttttcatcttattgt |
22377649 |
T |
 |
| Q |
213 |
nnnnnnnnnatttgactcatattcaaaatgctctgcc |
249 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
22377648 |
tttttttttatttgattcatattcaaaatgctctgcc |
22377612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University