View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_38 (Length: 245)
Name: NF1510_low_38
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 64 - 228
Target Start/End: Original strand, 44166199 - 44166363
Alignment:
| Q |
64 |
tagttgtagggtgcaatggttgagagaaaacattcaaagtagccatgtttgtgtctctcttttctgtttctatctacttttgcaacaaaaaagtcagcaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166199 |
tagttgtagggtgcaatggttgagagaaaacattcaaagtagccatgtttgtgtctctcttttctgtttctatctacttttgcaacaaaaaagtcagcaa |
44166298 |
T |
 |
| Q |
164 |
aggatcttagccgccacgtaatctttgcctattcttgctctctggcccaaccaaccacagatttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166299 |
aggatcttagccgccacgtaatctttgcctattcttgctctctggcccaaccaaccacagatttg |
44166363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University