View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_39 (Length: 237)
Name: NF1510_low_39
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 41884091 - 41884313
Alignment:
| Q |
1 |
tccatgaagtcagcttatattagtcnnnnnnnnagaggagtttatattagtcttattcactatcatcttcctccatctttgggagttattaaacaaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41884091 |
tccatgaagtcagcttatattagtcttttttttagaggagcttatattagtcttattcactatcatcttccttcatctttgggagttattaaacaaattt |
41884190 |
T |
 |
| Q |
101 |
ggcgctcgcggggtcgggagaggctaaggttgctcctttcgcaagtagcacacgataatttcttttgacaaatgagattcgtcaaaaatgtcacatatct |
200 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41884191 |
ggcgctcgcgaggttgggagaggctaaggttgctcctttcgcaagtagcacacgataatttcttttgacaaatgagattcgtcaaaaacgtcacatatct |
41884290 |
T |
 |
| Q |
201 |
caatatactttgtttcctatctg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41884291 |
caatatactttgtttcctatctg |
41884313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University