View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_40 (Length: 234)
Name: NF1510_low_40
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_40 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 32845208 - 32845424
Alignment:
| Q |
18 |
aaagcgaatcatatttcgcttcgaggttctcaatttgagacttaagagacaaaatgttgaaattctgcgatgcaatttttcgatcaaacagcaagcaccg |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845208 |
aaagtgaatcatatttcgcttcgaggttctcaatttgagacttaagagacaaaatgttgaaattctgcgatgcaatttttcgatcaaacagcaagcaccg |
32845307 |
T |
|
| Q |
118 |
ttgttccatggctccgatatttgcaagctttgaagctagaatacgagatttgtgcgcttgcaattctttctcagcctgaaaattgatatgtggattttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32845308 |
ttgttccatggctccgatatttgcaagctttgaagctagaatacgagatttgtgcgcttgcaattctttctcagcctgaaaattgatatgtggattttaa |
32845407 |
T |
|
| Q |
218 |
aaattggatgcttaaat |
234 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
32845408 |
aaattggatgctgaaat |
32845424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University