View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1510_low_41 (Length: 234)
Name: NF1510_low_41
Description: NF1510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1510_low_41 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 234
Target Start/End: Complemental strand, 39691487 - 39691454
Alignment:
| Q |
201 |
tatgtgttgtctttatttgtatctttctttgacc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39691487 |
tatgtgttgtctttatttgtatctttctttgacc |
39691454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University