View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15112_high_20 (Length: 247)

Name: NF15112_high_20
Description: NF15112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15112_high_20
NF15112_high_20
[»] chr1 (1 HSPs)
chr1 (52-232)||(4685821-4686001)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 52 - 232
Target Start/End: Complemental strand, 4686001 - 4685821
Alignment:
52 ttcaaacactattggttgcaccaaaacaaaaagtaacttagcatatggttataatataaatcatagtgtatctataaaatcaagacataaggttttaaat 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4686001 ttcaaacactattggttgcaccaaaacaaaaagtaacttagcatatggttataatataaatcatagtgtatctataaaatcaagacataaggttttaaat 4685902  T
152 tacagttacaaacatcttgattcttaatctatgcagcttgaattgaagttgcaaatgatcaattatgtttagcaagaaact 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
4685901 tacagttacaaacatcttgattcttaatctatgcagcttgaattgaagttgcaaatgatcaattatgttatgcaagaaact 4685821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University