View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15112_high_21 (Length: 241)
Name: NF15112_high_21
Description: NF15112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15112_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 227
Target Start/End: Original strand, 7170908 - 7171120
Alignment:
| Q |
2 |
tgaagcataatggaagattagcattttgcaagatggcattattttaaaagagatacatttgacacacccataaatgttgatgcaagtcaattatagcttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7170908 |
tgaagcataatggaagattagcattttgcaagatggcattattttaaaagagatacatttgacacacccataaatgttgatgcaagtcaattatagcttt |
7171007 |
T |
 |
| Q |
102 |
attttctccatccttttttgggatggatggggatattcatgtaacgctaaaggcatttaaataagcatactatataatgtgattattataaaagtcgtct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7171008 |
attttctccatccttttttgggatggatggggatattcatgtaacgctaaaggcatttaaataagcatac-------------tattataaaagtcgtct |
7171094 |
T |
 |
| Q |
202 |
ttgatgtttcaataattgatgaaggt |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7171095 |
ttgatgtttcaataattgatgaaggt |
7171120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University