View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15112_low_21 (Length: 246)
Name: NF15112_low_21
Description: NF15112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15112_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 2186067 - 2185837
Alignment:
| Q |
1 |
atcaagtttaagaagggctcgtttgtttcttttataacctttaccaactcaggaatccatactttttctgcttcttggtgcatcttgtggatcatgtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2186067 |
atcaagtttaagaagggctcgtttgtttcttttataacctttaccaactcatgaatccatactttttctgcttcttggtgcatcttgtggatcatgtcac |
2185968 |
T |
|
| Q |
101 |
tagttactttcattgtcaccgaggttccctgaaaagtttttcccttgaatatcaagtacaatcaacaaaaggaaaaatgactacgcaaaatatcaaaata |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2185967 |
tagttactttcattgtcactgaggttccctaaaaagtttttcccttgaatatcaagtacaatcaacaaaaggaaaaatgactacgcaaaatatcaaaata |
2185868 |
T |
|
| Q |
201 |
caatcaatagaagctgacgtggcaaaagaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2185867 |
caatcaatagaagctgacgtggcaaaagaag |
2185837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 7 - 133
Target Start/End: Original strand, 2179954 - 2180080
Alignment:
| Q |
7 |
tttaagaagggctcgtttgtttcttttataacctttaccaactcaggaatccatactttttctgcttcttggtgcatcttgtggatcatgtcactagtta |
106 |
Q |
| |
|
|||||||| || || || |||||||| || ||||| | |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2179954 |
tttaagaaaggttccttggtttctttcatgaccttcgctaactcaggaatccatattttttctgcttcttggtgcatcttctggatcatgtcactagtta |
2180053 |
T |
|
| Q |
107 |
ctttcattgtcaccgaggttccctgaa |
133 |
Q |
| |
|
|||| | ||||||||||||||||||| |
|
|
| T |
2180054 |
cttttgtcgtcaccgaggttccctgaa |
2180080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University