View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15113_high_11 (Length: 257)
Name: NF15113_high_11
Description: NF15113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15113_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 239
Target Start/End: Complemental strand, 36187227 - 36187001
Alignment:
| Q |
13 |
aatattatagtattcatgtgtcatatatctatataaagacatatggtatgggtatatcaccatcaaggcattaatcataattccataacatcgtccttgt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36187227 |
aatattatagtattcatgtgtcatatatctatataaagacatatggtattggtatatcaccatcaaggcattaatcataattccataacatcgtccttgt |
36187128 |
T |
 |
| Q |
113 |
gccgtttcattcatttatagagaaaactccactttaaaaaatttgttcctttatttcaaatggaattgggaagcatattgcactttcttgagggaagaac |
212 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36187127 |
gccatttcattcacttatagagaaaactccacttgaaaaaatttgttcctttatttcaaatggaattgggaagcatattgcactttcttgagggaagaac |
36187028 |
T |
 |
| Q |
213 |
aattttagtcactggtgccactggctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36187027 |
aattttagtcactggtgccactggctt |
36187001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University