View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15113_low_14 (Length: 239)

Name: NF15113_low_14

Description: NF15113

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF15113_low_14

[»] chr7 (1 HSPs)

[»] chr5 (1 HSPs)

Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 160; E-Value: 2e-85

Query Start/End: Original strand, 56 - 227

Target Start/End: Complemental strand, 31217177 - 31217006

Alignment:

Q	56	tagttggatgatttagtggagttgtccaagtctgatatgtgagaactgttccactaaaggtgattgtgattttctcatcaaaagttcttttgaaacataa	155	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	31217177	tagttggatgatttagtggagttgtccaagtttgatatgtgagaactgttccaccaaatgtgattgtgattttctcatcaaaagttcttttgaaacataa	31217078	T

Q	156	tccatggtggggcgagaagatggattctcactcaagcaagaaaatgccaattttgtaatcaagatgatgtcc	227	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	31217077	tccatggtggggcgagaagatggattctcactcaagcaagaaaatgccaattttgtaatcaagatgatgtcc	31217006	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 29; E-Value: 0.0000003

Query Start/End: Original strand, 176 - 220

Target Start/End: Complemental strand, 37028149 - 37028105

Alignment:

Q	176	tggattctcactcaagcaagaaaatgccaattttgtaatcaagat	220	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|
T	37028149	tggattcccactcaagcaagcaaatgccatttttgcaatcaagat	37028105	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]