View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15115_low_10 (Length: 268)
Name: NF15115_low_10
Description: NF15115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15115_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 3 - 262
Target Start/End: Complemental strand, 27115027 - 27114767
Alignment:
| Q |
3 |
gcaacgatgctggtaagttgatttatcatgaagctaagtaaagtctaactaataattattttagttatattttaaactcgcgtattataat-attaaatc |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
27115027 |
gcaatgatgctggtaagttgatttatcatgaagctaagtaaagtctaactaataattattttagttctattttaaactcgcgtattataatcattaaatc |
27114928 |
T |
 |
| Q |
102 |
tcattgcgcacttgatttaccacttgatttaaccactttaattttctttggccccctttaaccactttatgagaaaatgtgtttaatgtagttttaattg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27114927 |
tcattgcgcacttgatttaccacttgatttaaccactttaattttctttggccccctttaaccattttatgataaaatgtgtttaatgtagttttaattg |
27114828 |
T |
 |
| Q |
202 |
caagctattttagaatgttagagttggttaaaattttctaaaacttgatgatattcttcga |
262 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
27114827 |
cgggctattttagaatgttagagttggttaaaattttctaaaacttgatgatgtttttcga |
27114767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University