View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15116_low_9 (Length: 389)
Name: NF15116_low_9
Description: NF15116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15116_low_9 |
 | |
|
| [»] scaffold0330 (1 HSPs) |
| | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 6 - 369
Target Start/End: Complemental strand, 37635339 - 37634976
Alignment:
| Q |
6 |
agtagcaaagggcaaatttcctatctggcccaattaaacaaaaaatttgtgaagttcacatacctgactgccgcaagagcggtgagggaacctcgtaatt |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37635339 |
agtaccaaaaggcaaatttcctatctggcccaattaaacaagaaatttgtgaagttcacatacctgactgccgcaggagcggtgagggaacctcgtaatt |
37635240 |
T |
|
| Q |
106 |
tttaagagaactatcttaatatattcttccttattgcaccgcagcatttttgctcacctcactcccaattggatagaccggaggtgcgatgatttacttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37635239 |
tttaagagaactatcttaatatattcttccttattgcaccgcagcatttttgctcacctcactcccgattggatagaccggaggtgcgatgatttacttc |
37635140 |
T |
|
| Q |
206 |
acggacaagatctccggttcaagtccaggatggtccaatttatagtgagtttgtctttacatttaattcatccacgttacacacttatggacatctggat |
305 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37635139 |
acggaaaagatctccggttcaagtccaggatggtccaatttatagtgagtttgtctttacatttaattcatccacgttacacacttatggacatctggat |
37635040 |
T |
|
| Q |
306 |
gtaagagtaaagtcctctccggtatatcgtaatgcgtgttctaaggtgtttggatgcagacaca |
369 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37635039 |
gtaagagtaaagttctctccggtatatcgtaatgcgtgttctaaggtgtttggatgcagacaca |
37634976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 238
Target Start/End: Original strand, 491382 - 491453
Alignment:
| Q |
167 |
ctcccaattggatagaccggaggtgcgatgatttacttcacggacaagatctccggttcaagtccaggatgg |
238 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| | || |||| |||||||||||||||||| |
|
|
| T |
491382 |
ctcccaattggatggaccgtaggtgcgatgatttacttcacgggcgaggtctctggttcaagtccaggatgg |
491453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 289 - 376
Target Start/End: Original strand, 12403 - 12490
Alignment:
| Q |
289 |
cttatggacatctggatgtaagagtaaagtcctctccggtatatcgtaatgcgtgttctaaggtgtttggatgcagacacaaagatga |
376 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12403 |
cttatggacatctggacgtaagagtaaagttctctccggtatatcgtaatgcgtgttctaaggtgtttggatgcagacaaaaagatga |
12490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 238
Target Start/End: Original strand, 34654710 - 34654781
Alignment:
| Q |
167 |
ctcccaattggatagaccggaggtgcgatgatttacttcacggacaagatctccggttcaagtccaggatgg |
238 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| | || |||| |||||||||||||||||| |
|
|
| T |
34654710 |
ctcccaattggatggaccgtaggtgcgatgatttacttcacgggcgaggtctctggttcaagtccaggatgg |
34654781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 167 - 238
Target Start/End: Complemental strand, 13222793 - 13222722
Alignment:
| Q |
167 |
ctcccaattggatagaccggaggtgcgatgatttacttcacggacaagatctccggttcaagtccaggatgg |
238 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| | || |||| |||||||||||||||||| |
|
|
| T |
13222793 |
ctcccaattggatggaccgtaggtgcgatgatttacttcacgggcgaggtctctggttcaagtccaggatgg |
13222722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 170 - 238
Target Start/End: Original strand, 3856464 - 3856532
Alignment:
| Q |
170 |
ccaattggatagaccggaggtgcgatgatttacttcacggacaagatctccggttcaagtccaggatgg |
238 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| ||| | || |||| |||||||||||||||||| |
|
|
| T |
3856464 |
ccaattggatggaccgtaggtgcgatgatttactttacgagcgaggtctctggttcaagtccaggatgg |
3856532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 167 - 238
Target Start/End: Complemental strand, 186128 - 186057
Alignment:
| Q |
167 |
ctcccaattggatagaccggaggtgcgatgatttacttcacggacaagatctccggttcaagtccaggatgg |
238 |
Q |
| |
|
||||||||||| | || || ||| ||||||||||||||||||| | || |||| |||||||||||||||||| |
|
|
| T |
186128 |
ctcccaattggttggatcgtaggggcgatgatttacttcacgggcgaggtctctggttcaagtccaggatgg |
186057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University