View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15117_low_2 (Length: 338)
Name: NF15117_low_2
Description: NF15117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15117_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 4367556 - 4367339
Alignment:
| Q |
15 |
catcaagctaccaaaacatgaaaaagcttaaaccataacaccaattcaaacaacaatttacacatgcacnnnnnnnaacacaatttacacatgcacttaa |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4367556 |
catcaagccaccaaaacatgaaaaagcttaaaccataacaccaattcaaacaacaatttacacatgcactttttttaacacaatttacacatgcacttaa |
4367457 |
T |
 |
| Q |
115 |
aactaaaagataaacactagcatggaatcaaaaaatgaaccttttcaggaataacaaagccattgctatcttcttcaccagcattagccttatcaatgct |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4367456 |
aactaaaagataaacacttgcatggaatcaaaaaatgaaccttttcaggaataacaaagccattgctatcttcttcaccagcattagccttatcaatgct |
4367357 |
T |
 |
| Q |
215 |
atgaccaccacgattaaa |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4367356 |
atgaccaccacgattaaa |
4367339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University