View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15118_low_11 (Length: 241)
Name: NF15118_low_11
Description: NF15118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15118_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 44884333 - 44884110
Alignment:
| Q |
6 |
agaagcaaaggaggagtttgttaattcgacatcttaagctgttccttaagcctcccacaaagttagaacttt-ctgtgaccctggcaactaa-cgggggt |
103 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
44884333 |
agaatcaaatgaggagtttgttaattcgacatcttaagctgttccttaagcctcccacaaagttagaacttttctgtgaccctggcaactaaacgggggt |
44884234 |
T |
 |
| Q |
104 |
cc-aaggactttgcgcgtgtaaggcaatttggaatagcttaaaacaggtttatttgcttgtaattattgtaagaaaaaggttcataacaaacgtaaatgt |
202 |
Q |
| |
|
|| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44884233 |
cccaaggtctttgcgcgtgaaaggcaatttggaatagcttaaaacaggtttatttgcttgtaattattgtaagaaaaaggttcataacaaacgtaaatgt |
44884134 |
T |
 |
| Q |
203 |
ccaagtttaaatcaaggtaggtat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44884133 |
ccaagtttaaatcaaggtaggtat |
44884110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University