View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15119_high_1 (Length: 222)
Name: NF15119_high_1
Description: NF15119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15119_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 41253175 - 41253356
Alignment:
| Q |
20 |
catgatgcattcatatgtttgtgaatgatgctattcattcgatgatggaattgnnnnnnnnnnnnntaagtcagtcatttttgcacaaattatttttaca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41253175 |
catgatgcattcatatgtttgtgaatgatactattcat-cgatgatggaattgaaaaaaataaaaataagtcagtcatttttgcacaaattatttttaca |
41253273 |
T |
 |
| Q |
120 |
aatatatcaattattttgagagaaatagagtactataatcagtcatcatcatatctgttcaaatcaaacaacgagccccatgt |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41253274 |
aatatatcaattattttgagagaaaaagagtactatattcagtcatcatcatatctgttcaaatcaaacaacgagccccatgt |
41253356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University