View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15119_low_1 (Length: 222)

Name: NF15119_low_1
Description: NF15119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15119_low_1
NF15119_low_1
[»] chr8 (1 HSPs)
chr8 (20-202)||(41253175-41253356)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 41253175 - 41253356
Alignment:
20 catgatgcattcatatgtttgtgaatgatgctattcattcgatgatggaattgnnnnnnnnnnnnntaagtcagtcatttttgcacaaattatttttaca 119  Q
    ||||||||||||||||||||||||||||| |||||||| ||||||||||||||             ||||||||||||||||||||||||||||||||||    
41253175 catgatgcattcatatgtttgtgaatgatactattcat-cgatgatggaattgaaaaaaataaaaataagtcagtcatttttgcacaaattatttttaca 41253273  T
120 aatatatcaattattttgagagaaatagagtactataatcagtcatcatcatatctgttcaaatcaaacaacgagccccatgt 202  Q
    ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
41253274 aatatatcaattattttgagagaaaaagagtactatattcagtcatcatcatatctgttcaaatcaaacaacgagccccatgt 41253356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University