View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_103 (Length: 296)
Name: NF1511_high_103
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 286
Target Start/End: Original strand, 51294443 - 51294701
Alignment:
| Q |
20 |
gtattgacaagaaagcttctgctttcattgctagattctatgccaaccgagccactgattctgagcaacaaattgcttcttgaaatttcattttaacttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294443 |
gtattgacaagaaagcttctgctttcattgctagattctatgccaaccgagccactgattctgagcaacaaattgcttcttgaaatttcattttaacttc |
51294542 |
T |
 |
| Q |
120 |
ttcgttcattcttgtttttcctaccaataatccccctccccaaatgtaaaatataatgttttctttatttggttgtagtcagttttataataatttactg |
219 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294543 |
ttc----attcttgtttttcctaccaataatccccctccccaaatgtaaaatataatgttttctttatttggttgtagtcagttttataataatttactg |
51294638 |
T |
 |
| Q |
220 |
cagttgttcttgatcagcgtttgattatatatatatgatggtggtctagttctttcttttccctttg |
286 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294639 |
cagttgttcttgatcatcgtttgat----tatatatgatggtggtctagttctttcttttccctttg |
51294701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University