View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_116 (Length: 282)
Name: NF1511_high_116
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 6 - 268
Target Start/End: Original strand, 27835581 - 27835843
Alignment:
| Q |
6 |
cagcttttgttttcaatttggcaactttcccactggcaacccaattgtgtatgtagtttctgaaggatgaatgaattcaaatgagaactaaggccatagc |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27835581 |
cagcttttgttttcgatttggcaactttcccattggcaacccaattgtgtatgtagtttctgaaggatgaatgaattcaaatgagaactaaggccatagc |
27835680 |
T |
 |
| Q |
106 |
aatcattttaatggtaaaatattttgagcaagaaataccttggttctgtatcttcttgcatcttcatcagtgcttcaattccagcacagctactatgacc |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27835681 |
aatcattttaaccgtaaaatattttgagcaagaaataccttggttctgtatcttcttgcatcttcatcagtgcttcaattccagcacagctactatgacc |
27835780 |
T |
 |
| Q |
206 |
aatgactaatatattttcaacctaaaaatttcagcaaccatttgcattcaattttgcagtgcc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27835781 |
aatgactaatatattttcaacctaaaaatttcagcaaccatttgcattcaattttgcagtgcc |
27835843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University