View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_123 (Length: 276)
Name: NF1511_high_123
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 33435640 - 33435389
Alignment:
| Q |
11 |
caaaggtttagaaattagaagtttaacttttctccttttgtgtgaaaaacaggtgcaacgaacacggtgaattattgaggaaaaacagtgtgcatgcatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
33435640 |
caaaggtttagaaattagaagtttaacttttctccttttgtgtgaaaaacaggtgcaacgaacacggtgaataattgagcaaaaacagtgtgcatgcatt |
33435541 |
T |
 |
| Q |
111 |
aaatgctacgacctgctattgttagtagttgaaaccaattaaagtgatagaggggccaacatagtataacatatatcctcttccgggttataaaagcctc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435540 |
aaatgctacgacctgctattgttagtagttgaaaccaattaaagtgatagaggggccaacatagtataacatatatcctcttccgggttataaaagcctc |
33435441 |
T |
 |
| Q |
211 |
atgttagcttatgcatactacaccaaccaggatagatatcaaatagaaagtg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33435440 |
atgttagcttatgcatactacaccaaccaggatagatatcaaatagaaagtg |
33435389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University