View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_134 (Length: 254)
Name: NF1511_high_134
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_134 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 4303634 - 4303872
Alignment:
| Q |
1 |
acaataacaacctcggatgttgttactaaccagaaaaacgttaaccctttcgttccacctcattcaagagtgaaaagatcgttaatgggtgatttgtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4303634 |
acaataacaacctcggatgttgttactaaccagaaaaacgttaaccctttcgttccacctcattcaagagtgaaaagatcgttaatgggtgatttgtcat |
4303733 |
T |
 |
| Q |
101 |
gttctcaggttcatccacatgcttttccaacacataggagacaatcttcaactgatttgttcacggagttggatcatatgagaagcttgttacaagagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4303734 |
gttctcaggttcatccacatgcttttccaacacataggagacaatcttcaactgatttgttcacggagttagatcatatgagaagcttgttacaagagtc |
4303833 |
T |
 |
| Q |
201 |
taaggagagagaggccaagttgaatgctgagttggttga |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4303834 |
taaggagagagaggccaagttgaatgctgagttggttga |
4303872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 40772001 - 40771930
Alignment:
| Q |
102 |
ttctcaggttcatccacatgcttttccaacacataggagacaatcttcaactgatttgttcacggagttgga |
173 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||||| | || ||||||||||||| |||||| |
|
|
| T |
40772001 |
ttctcaggttcacccacatgtttttacaacacataggagacaatcacccacagatttgttcacggcgttgga |
40771930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University