View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_150 (Length: 245)
Name: NF1511_high_150
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_150 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 40790982 - 40790757
Alignment:
| Q |
1 |
ttggttactctgcatattcatggaggtgaagaatattggtggggaacaaatcattnnnnnnnngtaagataattaaggatcttttacaatatgcctttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40790982 |
ttggttactctgcatattcatggaggtgaagaatattggtggggaacaaatcattaaaaaaaagtaagataattaaggatcttttacaatatgcctttgc |
40790883 |
T |
 |
| Q |
101 |
atattatatggacccttctcccacgtatggccacatctacatatatatgaagnnnnnnnnncatgaatggaatttttagcactgaagtgagaaagaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40790882 |
atattatatggacccttctcccacgtatggccacaactacatatatatgaag-aaaaaaaacatgaatggaatttttagcactgaagtaagaaagaatct |
40790784 |
T |
 |
| Q |
201 |
ttagtattttgatcgatgaccccatct |
227 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
40790783 |
ttagtattttgattgatgaccccatct |
40790757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University