View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_175 (Length: 234)
Name: NF1511_high_175
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_175 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 55131051 - 55130829
Alignment:
| Q |
1 |
atatatcaaattaaacatcctcacaacattaacaaannnnnnnatcattcttc-ta---agttctaagagacatcatagaaaaataatctactgcttaat |
96 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55131051 |
atatatcaaattaaacatcctcacaactttaacaaatttttttatcattcttcatatccagttctaagagacatcatagaaaaataatctactgcttaat |
55130952 |
T |
 |
| Q |
97 |
tattgttgtgtgtaatcaagaaaatgggaaactgttgcaaaccatcatcttcaatggagtgggttggggaggactgggaatctttgaggtctaaacctga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55130951 |
tattgttgtgtgtaatcaagaaaatgggaaactgttgcaaaccatcatcttcaatggagtgggttggggaggactgggaatctttgaggtctaaacctga |
55130852 |
T |
 |
| Q |
197 |
atcaaggaagacaaagccatatc |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55130851 |
atcaaggaagacaaagccatatc |
55130829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 183
Target Start/End: Complemental strand, 55126120 - 55126043
Alignment:
| Q |
106 |
gtgtaatcaagaaaatgggaaactgttgcaaaccatcatcttcaatggagtgggttggggaggactgggaatctttga |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || |||||||||||| | ||| || ||||||| |||||||| |
|
|
| T |
55126120 |
gtgtaatcaagaaaatgggaaactgttgcagggcagcaccttcaatggagtttggtggagaagactggggatctttga |
55126043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University