View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_183 (Length: 228)
Name: NF1511_high_183
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_183 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 23939415 - 23939609
Alignment:
| Q |
20 |
atagccaaagatggaaagtatagtgtgagtgatgtgatgatgacagaagaagggagagcacactcccaacaaaggcaaagactctctttacaaccattcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23939415 |
atagccaaagatggaaagtatagtgtgagtgatgtgatgatgacagaagaagggagagcacactcccaacaaaggcaaagactctctttacaaccattcc |
23939514 |
T |
 |
| Q |
120 |
cgggttgtgctctctctcttctgtcaacatgaaatgtctcatcacatatttcctcaactataccaaccaacaaaacccttcttgccatgcattct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23939515 |
cgggttgtgctctctctcttctgtcaacatgaaatgtctcatcacatatttcctcaactataccaaccaacaaaacccttcttgccatgcattct |
23939609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University