View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_184 (Length: 227)
Name: NF1511_high_184
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_184 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 7211942 - 7212153
Alignment:
| Q |
1 |
aaaaattatataggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211942 |
aaaaattatataggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagta |
7212041 |
T |
 |
| Q |
101 |
ggtatgatgtcaagagaatatgctcaagctcaactctaattaccggagatctcgcaaaacgttctcctaaagactctacccctcccgcaaccacagccga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7212042 |
ggtatgatgtcaagagaatatgctcaagttcaactctaattaccggagatctcgcaaaacgttctcctaaagactccacccctcccgcaaccacagccga |
7212141 |
T |
 |
| Q |
201 |
ggacttcaattc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7212142 |
ggacttcaattc |
7212153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 53233919 - 53233865
Alignment:
| Q |
11 |
taggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttag |
65 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
53233919 |
taggcactcaagaagaagctgcagaagcgtatgatattgcagcaatcaaatttag |
53233865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 113
Target Start/End: Complemental strand, 30618393 - 30618291
Alignment:
| Q |
11 |
taggcacgcaagaagaggctgcagaagcatatgatattgcagcaatcaagtttaggggaacaagtgctgtgaccaactttgacataagtaggtatgatgt |
110 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||| | |||||||| || || || ||| ||||| || || ||||||||||| || || |||||||| |
|
|
| T |
30618393 |
taggcactcaagaagaggcagcagaggcatatgatgtggcagcaataaaattcagaggactgagtgcagttacaaactttgacatgagcagatatgatgt |
30618294 |
T |
 |
| Q |
111 |
caa |
113 |
Q |
| |
|
||| |
|
|
| T |
30618293 |
caa |
30618291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University