View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_34 (Length: 452)
Name: NF1511_high_34
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 14 - 436
Target Start/End: Complemental strand, 37876859 - 37876437
Alignment:
| Q |
14 |
gagatgaaatgtattcaaccgtcgttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatccgaaccttcaatgttgatttcga |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37876859 |
gagatgaaatgtattcaaccgtctttgaaagaggttcctagtgtgcctttggttgttgatcatttgccggaattatcggaaccttcaatgttgatttcga |
37876760 |
T |
 |
| Q |
114 |
atagtttgaggaatgtggtttatgatgcacttccggctttaattcataggaagaaatggttaatgatgtacaggtagttttggattaaggtttttgaagg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37876759 |
atagtttgaggaatgtggtttatgatgcacttccggctttaattcatgggaagaaatggttaatgatgtacaggtagttttggattaaggtttttgaagg |
37876660 |
T |
 |
| Q |
214 |
acacaagattatgctgttgtgttttgaagtttcaaaatcttgttgattttattgatataatcttatgtggtttctttgcagcacatggaaacatggaata |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37876659 |
acacaagattatgctgttgtgttttgaagtttcaaaatcttgttgagtttattgatataatcttatgtggtttctttgcagcacatggaaacatggaata |
37876560 |
T |
 |
| Q |
314 |
tcactttcaactctttaccgaagaagcatgctttggcctggacctagtttgctggtaaaatttcattgtccttcagcacaaataagcttaagttgtttat |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37876559 |
tcactttcaactctttaccgaagaagcatgctttggcctggacctagtttgctggtaaaatttcattgtccttcagcacaaataagcttaagttgtttat |
37876460 |
T |
 |
| Q |
414 |
gatttatccatctttgttctttc |
436 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37876459 |
gatttatccatctttgttctttc |
37876437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 288 - 370
Target Start/End: Complemental strand, 39549295 - 39549213
Alignment:
| Q |
288 |
tttgcagcacatggaaacatggaatatcactttcaactctttaccgaagaagcatgctttggcctggacctagtttgctggta |
370 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||| |
|
|
| T |
39549295 |
tttgcagcacttggaggaatggtatatcactttcaactctttaccggagaagcatgttatggcctggattgagtttgctggta |
39549213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University