View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_48 (Length: 412)
Name: NF1511_high_48
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 21 - 408
Target Start/End: Original strand, 35915850 - 35916237
Alignment:
| Q |
21 |
cgagaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915850 |
cgagaagccgagagatatggcttgggagagaaggaggagacaagaaataaggaggagtattgttcaagattgtgtttgtgatgatataactgatgatgat |
35915949 |
T |
|
| Q |
121 |
ttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35915950 |
ttgcatgaacttaaaggatgcattgaacttgggtttggattcaatgaagaagatggtcagagattgtgtaatacattgcctgcccttgatctttattttg |
35916049 |
T |
|
| Q |
221 |
ctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtga |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916050 |
ctgttaatagaggtttgtcaccaagccctgtttctacacctcaaagtcgtgcttcatcccttggggctcgttcttcttcctttggaagccctagaagtga |
35916149 |
T |
|
| Q |
321 |
tgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcannnnnnngccttaatcctttgcttctc |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35916150 |
tgctgactcatggaagatttgtagcccaggttaactttctttgcatttttcttaacaatcatttttttgccttaatcctttggttctc |
35916237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University