View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_66 (Length: 364)
Name: NF1511_high_66
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 43 - 193
Target Start/End: Original strand, 40882819 - 40882970
Alignment:
| Q |
43 |
cttacaatctctatgcgatgaactatata-tctctgaccttatatcttccaacacatctttttcactacgactatgctaaatttctactaaatcttcatt |
141 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40882819 |
cttacaatctctatgcgatgaactatttaatctctgaccttatatcttccaacacatctttttcactacgactatgctaaatttctactaaatcttcatt |
40882918 |
T |
|
| Q |
142 |
taattatggttcatgcatccaaacaaaagtacaaaacacaatctgtcaaata |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40882919 |
taattatggttcatgcatccaaacaaaagtacaaaacacaatctgtcaaata |
40882970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 258 - 349
Target Start/End: Original strand, 40883035 - 40883126
Alignment:
| Q |
258 |
tcaagggttgtgccccataaattcctctgccatgatgggcaatgtcgcagcgtcttgctttcaccgcgtaagacaaatatcattgtcgtcaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40883035 |
tcaagggttgtgccccataaattcctctgccatgatgggcaatgtcgcagcgtcttgctttcaccgcgtaagacaaatatcattgtcgtcaa |
40883126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 44 - 193
Target Start/End: Complemental strand, 8909182 - 8909032
Alignment:
| Q |
44 |
ttacaatctctatgcgatgaactatata-tctctgaccttatatcttccaacacatctttttcactacgactatgctaaatttctactaaatcttcattt |
142 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8909182 |
ttacaatctctatgtgatgaactatataatctctgaccttatatcttccaacacatctttttcactacgactatgctaaatttctactaaatcttcattt |
8909083 |
T |
|
| Q |
143 |
aattatggttcatgcatccaaacaaaagtacaaaacacaatctgtcaaata |
193 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8909082 |
aattatggttaaagcatcgaaacaaaagtacaaaacacaatctgtcaaata |
8909032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 258 - 349
Target Start/End: Complemental strand, 8908967 - 8908877
Alignment:
| Q |
258 |
tcaagggttgtgccccataaattcctctgccatgatgggcaatgtcgcagcgtcttgctttcaccgcgtaagacaaatatcattgtcgtcaa |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8908967 |
tcaagggttgtgccccataaattc-tctgccacgatgggcaatgtcacagtgtcttgctttcaccgtgtaagacaaatatcattgtcgtcaa |
8908877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University