View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_74 (Length: 350)
Name: NF1511_high_74
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_74 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 4872 - 4550
Alignment:
| Q |
1 |
gtgacaaaaatgcaattaattaatctattatattggttgaggtagaaaattagaataatgtcttgaaatgcaacaaagaacatttgtgacacctttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4872 |
gtgacaaaaatgcaattaattaatctattatattggttgaggtagaaaattagaataatg----------caacaaagaacatttgtgacacctttcact |
4783 |
T |
 |
| Q |
101 |
aagaaaaagaacatccaaatttgctaggtttatgtagttttcatattatactaagaatactttattgtcataaacataacaaataaatcttgctttcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4782 |
aagaaaaagaacatccaaatttgctaggtttatgtagttttcatattttactaataaccctttattgtcataaacataacaaataaatcttgctttcctt |
4683 |
T |
 |
| Q |
201 |
gatattattttgcaaccaaagttatcaaaagagagttagcaaaagtgacaattgaatacacttaactctcaactgtcttctccattccatatctaaacta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4682 |
gatattattttgcaaccaaagttatcaaaagagagttagcaaaagtgacaattgaatacacttaactctcaactgtcttctccactccatatctaaacta |
4583 |
T |
 |
| Q |
301 |
cagttattctgttgtagcaagatagtgacattg |
333 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4582 |
cagttattctgttgtaccaagatagtgacattg |
4550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University