View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_76 (Length: 345)
Name: NF1511_high_76
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 13660358 - 13660095
Alignment:
| Q |
13 |
aatattcaaatcccaaatataatcttatttcagtggacaacacnnnnnnncccgtgattttacataggatatatccactaaagataatcttatttgagac |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
13660358 |
aatattcaaattccaaatataatcttatttcagtggacaacacttttttccccgtgattttacatagggtatatccactaaaaataatcttatttgagac |
13660259 |
T |
 |
| Q |
113 |
atgatttataccaaatatgaatatctcattattatgaatgtctcattagtcgaaatttgaatatagatccattgagttgtggcaactctcctacaatgcc |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13660258 |
gtgattaataccaaatatgaatatctcattattatgaatgtctcattagtcgaaatttgaatatagatccatcgagttgtgacaactctcctacaatgcc |
13660159 |
T |
 |
| Q |
213 |
cctcttttatgactagactatttcacacctttcacacacacaaaaggttaattcaaattgattt |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13660158 |
cctcatttatgactagactatttcacacctttcacacacacaaaaggttaattcaaattgattt |
13660095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 299 - 330
Target Start/End: Complemental strand, 13660078 - 13660047
Alignment:
| Q |
299 |
caatttatttctctcttttataggtagaatct |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13660078 |
caatttatttctctcttttataggtagaatct |
13660047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University