View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_90 (Length: 320)
Name: NF1511_high_90
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 286
Target Start/End: Original strand, 3946819 - 3947103
Alignment:
| Q |
8 |
agataattcttttggaatatttagttttagtgaataaaaattataaactaatttcaactatgacaaacgtggtctcttaaaagtagaagctaattttttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3946819 |
agataattcttttggaatatttagttttagtgaataaaaattataaactaatttcaactatgacaaacgtggtctcttaaaagtagaagctaattttttc |
3946918 |
T |
 |
| Q |
108 |
aacaatttttattagtttttc------tatnnnnnnnnnnnnnttattagtttataannnnnnnaataaatgtaaaacacaattgtgtttgattcaatag |
201 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3946919 |
aacaatttttattagtttttctatatatatatatatatatatattattagtttataatttttttaataaatgtaaaacacaattgtgtttgattcaatag |
3947018 |
T |
 |
| Q |
202 |
cttttggttttgaacacaaaattatttctattgatccttgaataaaatgggaccaactcactcgaaaatgaatatttgaaatttg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3947019 |
cttttggttttgaacacaaaattatttctattggtccttgaataaaatgggaccaactcactcgaaaataaatatttgaaatttg |
3947103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 166 - 286
Target Start/End: Original strand, 3953800 - 3953920
Alignment:
| Q |
166 |
aataaatgtaaaacacaattgtgtttgattcaatagcttttggttttgaacacaaaattatttctattgatccttgaataaaatgggaccaactcactcg |
265 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||| |||| || | ||||||||||||||||||| |||| |
|
|
| T |
3953800 |
aataaatgtaaaagacaattgtttttgattcaatagcttttggtcttgaacacaaaattatttccattggtcttggaataaaatgggaccaacttcctcg |
3953899 |
T |
 |
| Q |
266 |
aaaatgaatatttgaaatttg |
286 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3953900 |
aaaatgaatatttgaaatttg |
3953920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University