View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_high_92 (Length: 319)
Name: NF1511_high_92
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_high_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 170 - 309
Target Start/End: Original strand, 51534328 - 51534467
Alignment:
| Q |
170 |
ctttggtggtctcttccgaagctctaatggtgcttggtgtgctgactttttagatattcgaagttcaactcacatcctctaagcatcattttatggcatt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51534328 |
ctttggtggtctcttccgaagctctaatggtgcttggtgtgctggctttttagatattcgaagttcaactcacatcctctgagcatcattttatggcatt |
51534427 |
T |
|
| Q |
270 |
catggaagaataactcttgctaaaaacataagtccctatg |
309 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
51534428 |
catggacgaataactcttgctaaaaacataagtctctatg |
51534467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University