View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_103 (Length: 313)
Name: NF1511_low_103
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 14 - 306
Target Start/End: Complemental strand, 29280414 - 29280121
Alignment:
| Q |
14 |
tacttggattcagctgactggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcataac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29280414 |
tacttggattcagctgactggaaaatgcgacatgcaggaattacattgctcactgtgatttccaaagagttttctgatgaaatggtgacttcatcatagc |
29280315 |
T |
 |
| Q |
114 |
tataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttcttgcaccaacacatacatcattttatgcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
29280314 |
tataatctcttgttctttcattaacatctttcatgcatatgatattgatactatgctactaactatagttcttggactaacacatacaccattttatgcc |
29280215 |
T |
 |
| Q |
214 |
tagttcttgccctagcacatacataatttcttgcactagcatttgttagggaatatatagaggattaagtttatattttga-ttatacttgaga |
306 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
29280214 |
tagttcttgccctaacacatacataatttcttgcactagcatttgttagggaatatatagaggactaagtttatattttgatttatacttgaga |
29280121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University