View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1511_low_113 (Length: 292)

Name: NF1511_low_113
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1511_low_113
NF1511_low_113
[»] chr6 (1 HSPs)
chr6 (19-282)||(10976891-10977154)


Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 10976891 - 10977154
Alignment:
19 gcaacatgccacaagcttggcctcgttttgatagattatccttatgaatcaaataaattccatgatggatctctagaaagcaatgcacattccaataggt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
10976891 gcaacatgccacaagcttggcctcgttttgatagattatccttatgaatgaaataaattccatgatggatctctagaaagcaatgcacattccaataggt 10976990  T
119 cgcttcaatgtgttgcagatgatgcgattgaaggagacaccatggaacaccataaccatatggagagggttgaacttgagcacactgttgcacatgaggc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10976991 cgcttcaatgtgttgcagatgatgcgattgaaggagacaccatggaacaccataaccatatggagagggttgaacttgagcacactgttgcacatgaggc 10977090  T
219 tattcagtttgattttgaggagctcatcttcaaagagcaacaacatgattaatatgctcctttg 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10977091 tattcagtttgattttgaggagctcatcttcaaagagcaacaacatgattaatatgctcctttg 10977154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University