View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_115 (Length: 289)
Name: NF1511_low_115
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 45715176 - 45714919
Alignment:
| Q |
18 |
gttctgtgatggagcatctcagtttgagtagtaatttgttgacaggctctatacctgaggagctttgtaatgccgcatcgatgtcggagattgatcttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45715176 |
gttctgtgatggagcatctcagtttgagtagtaatttgttgacaggctctatacctgaggagctttgtaacgccgcatcgatgtcggagattgatcttga |
45715077 |
T |
 |
| Q |
118 |
tgataacaaccttagtggtacaattgagaaagcttttgtgaattgtaagaaccttactcaattggttttgatgaataatcagattgttggttctatacca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45715076 |
tgataacaaccttagtggtacaattgagaaagcttttgtgaattgtaagaaccttactcaattggttttgatgaataatcagattgttggttctatacca |
45714977 |
T |
 |
| Q |
218 |
cagtacctttctgagcttcctttgatggtgctggacttggacaacaacaatttcagtg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45714976 |
cagtacctttctgagcttcctttgatggtgctggacttggacaacaacaatttcagtg |
45714919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University