View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_127 (Length: 280)
Name: NF1511_low_127
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_127 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 262
Target Start/End: Complemental strand, 6265495 - 6265246
Alignment:
| Q |
13 |
aatataataattaaaaatctaatcttattgggtatattgggaccctttttcacatgggccaaattcgctagaaccctctccctccatattcatctcacct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6265495 |
aatataataattaaaaatctaatcttattgggtatattgggaccctttttcacatgggccaaattcgctagaaccctcttcctccatattcatctcacct |
6265396 |
T |
 |
| Q |
113 |
tgccttttcttttaatattaatatactagattttgttttgaagcaaataatatactagcattaaagtatgnnnnnnntagtcttagatatattgatcaca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6265395 |
tgccttttcttttaatattaatatactagattttgttttgaagcaaataatatactagcattaaagtatgaaaaaaatagtcttagatatattgatcaca |
6265296 |
T |
 |
| Q |
213 |
tagtgtaagnnnnnnntggaacatttctaaggtatgatccttgagacatg |
262 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6265295 |
tagtgtaagaaaaaaatggaacatttctaaggtatgatccttgagacatg |
6265246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University