View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_130 (Length: 277)
Name: NF1511_low_130
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_130 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 14553250 - 14553096
Alignment:
| Q |
1 |
tgaaagaaaatgtactagactaaaactatgtatccttttttatataatggtatatacaatttaaataaatacaaagtaaaaagacattgactactacata |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14553250 |
tgaaagaaaatgtactacactaaaactatgtatcctttt--atataatggtatatatagtttaaataaatacaaagtaaaaagacattgactactacata |
14553153 |
T |
 |
| Q |
101 |
gtcatgcatatac---nnnnnnnnaaataataatcatgcatatacaattaattatat |
154 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
14553152 |
gtcattcatatactttttatttttaaataataatcatgcatatactattaattatat |
14553096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 214 - 261
Target Start/End: Complemental strand, 14553003 - 14552956
Alignment:
| Q |
214 |
ctcatttaggaccatgaagcaaagtatatatgcattcattcacaatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14553003 |
ctcatttaggaccatgaagcaaagtatatatgcattcattcacaatgt |
14552956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University