View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_140 (Length: 264)
Name: NF1511_low_140
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_140 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 15889633 - 15889874
Alignment:
| Q |
9 |
gaacaaaatcactcacatttacaattttcttagg-gctaaacagttaaaatgtattatactaaactactagtactaactttcatccaataaaatccaaga |
107 |
Q |
| |
|
||||||||||||||||| || ||||| ||||| | || ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
15889633 |
gaacaaaatcactcacactttcaattctcttaagtgccaaacaattgaaatgtattatactaaactactagtactaactttcatccaataaaatcagaaa |
15889732 |
T |
 |
| Q |
108 |
attgattaaaatttaacaaataatcaatacaagtatattcaaattgatgaaactctagaagaacctggtttgtttcttggagctcgacgagagataagcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15889733 |
attgattaaaatttaacaaataatcaatacaagtatgttcaaattgatgaaactctagaagaacctgctttgtttcttggagctcgacgagagataagcc |
15889832 |
T |
 |
| Q |
208 |
cgaaaacttgcttaatattaatttgatgacctctgagaaaac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15889833 |
cgaaaacttgcttaatattaatttgatgacctctgagaaaac |
15889874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University