View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1511_low_145 (Length: 253)
Name: NF1511_low_145
Description: NF1511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1511_low_145 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 29280108 - 29279873
Alignment:
| Q |
1 |
aaacataaaaataataattttatagatgatcatgtaacattttatcacacacttgattattannnnnnnngaaatgtttta-tagaaaataagttctcgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||| |||||||||||||||| | |
|
|
| T |
29280108 |
aaacataaaaataataattttatagatgatcatgtaacattttataacac--ttgattattattttttt-gaaatgttttaatagaaaataagttctcac |
29280012 |
T |
 |
| Q |
100 |
cccccttctcttaataaatcctcgattcaaacacactcttctaagaaagggaaaggattaaaaggggtgttgttggtttggcataggatgtcgtggcaaa |
199 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29280011 |
cccccttctcttaataaatcctccattcaaacacactcttctaagaaagggaaaggattaaaaggggtgttgttggtttggcataggatggcgtggcaaa |
29279912 |
T |
 |
| Q |
200 |
tttgaaaggctagaaataactacgttttttattcaaaag |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
29279911 |
tttgaaaggctagaaataactacattttttgttcaaaag |
29279873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University